Bio:Seq $seq_obj->accession_number not returning accession number?

classic Classic list List threaded Threaded
1 message Options
Reply | Threaded
Open this post in threaded view
|

Bio:Seq $seq_obj->accession_number not returning accession number?

Sam Al-Droubi
The fasta format for this sequence AF410462 from NCBI looks like this
 
 
>gi|17066572|gb|AF410462.1|AF410462 Mus musculus PEM homeobox (Pem) gene, promoter region and partial cds
ATGCGTGTGGGCATGCGCTCATGCCCACTTGCTTGAGCACATGTGTGCTCACATGGACGTTAGAGGCAAC
TTTCAGGAGTTATTTTTTTCCCTTCTAACTTGAGTTCCTGGACCTCAGACTTGTATAATAGGTACTTTCC
CAACTTAAGTCTTACTGGCTCCAGGGTATCTGGTATACTCTTCTAGCCTCCAAGGGCAGCCACTCATGCT
TCTTCAGGTGTGAAGAGGTGAGCCAGATACAACGGTGGGAGGCAGTGTGCCCTCAGTGTGTAGACTCTTT
ATGCCCTTGGGGATTAGCGCCTCTAGCTGCCAGTCGGGTCTCTGGGTCCCTCCTGCTAAGGCCACTCTCG
TCATGGTTCCTCTTGTCCTGGTGAGCCATTACGACCCTCTCACTTCCTTGTGTTCTCTTCCCTGTGTTCT
CTCTCTGCTGCTGTGGCCATTCTAGCTCCCTGCACAGTCCTTCAAGCTCACCTCCTGCCTTCCGTGGACA
AGAGGAAGCACAAAGAATCATCCAGTATGTATGCTCATGGCATAAGGGGATCCTGGGGAAGGGCTGAAGC
CTGAGCCGGGCTGGTCAACAGAATCTCCCTCTCCCTAACTCCATCTCCCTCTCCTTCCCTCTTCCTCTCT
CTATCCCTCCCCCCTCTCTCCCCCCACCACCGCATGTTTTGGGTCAGCTGACTGCTCTAGCCTTGATGAG
ATATCTTCCCAGGAAGAGTTGGTGCTGACTGTACAGATTGAGTTAGAGGGAGGGAAGAAAGCTCCTGTTT
GATCACTGGAGATCTTTATGCCTAGCTACATGTCTTACCAAAGCCAGGGGAGTCAGCTGAGCTGTAACTG
GGCACCCTAAGTTCTGCACACCCACATGCCCATGAACTGTGTCCATCTTGCAAGCACATCGTGCTCATTA
CATCCCCAAACTGCTATCACTTGTGTACCCCAAAGGCTCGGCCCACAGGAACGTCCTGTGAGCAAATCAC
AAAGACCAGCTTAGGGCTGGAAACATTGTAACCTGAAGTAGGCCAGAGGAGATCCCTGCCAGGTTGAGCA
TCACAGATCTCATTCTGTTCCCGGGGACACCAGGGGCCCAAGCTCAGAATCTGCCGAAGCATAACTTCAT
CATTGATCCTATTCAGGGTATGGAAGCTGAGGGTTCCAGCCGCAAGGTCACCAGGCTACTCCGCCTGGGA
GTCAAGGAAG
 
 When I read this from a file as a sequence object using Bio::Seq I get accession_number unknow.  The
 accession number is in the header of the fasta file.  Anyone knows why this happens.
 
 My code looks like this:
 
 print "primary id is: ",$seq_obj->primary_id."\n";
 print "Description is ",$seq_obj->desc."\n";
 print "Accession Number is ",$seq_obj->accession_number."\n";
 
 Output looks like this:
 
 primary id is: gi|17066572|gb|AF410462.1|AF410462
 Description is Mus musculus PEM homeobox (Pem) gene, promoter region and partial cds
 Accession Number is unknown
 
 
 Thank you.
 
 
 


Sincerely,
Sam Al-Droubi, M.S.
[hidden email]
_______________________________________________
Bioperl-l mailing list
[hidden email]
http://portal.open-bio.org/mailman/listinfo/bioperl-l