remoteblast

classic Classic list List threaded Threaded
6 messages Options
Reply | Threaded
Open this post in threaded view
|

remoteblast

Jolyon Holdstock
Hi,

I have a script that runs blast jobs against the databases at the NCBI.

I use the  Bio::Tools::Run::RemoteBlast module for the blasting.

It was working but is not now.

The following is an example of the response I now get:

--------------------- WARNING ---------------------
MSG: req was POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
User-Agent: bioperl-Bio_Tools_Run_RemoteBlast/1.006901
Content-Length: 788
Content-Type: application/x-www-form-urlencoded

DATABASE=nr&QUERY=%3EHCV-54_contig_15+%0D%0ATCATAACAACCTTTTATGGTAAATACTAACAGCATGCCCATTTTACATGTGAGGAAACTGAGGCTTAGATCAGGTAAGTAGCTTATTCAGTGTTGCTCAAGTAAATACGTTTTAAGAACCCTCAGCCTCGCTCTCCTCTTCCTCAGGGCACACTTTTTTTTTTTTCCTTCCTACTGTGTGAGCTGTGGTGGGAATGTTAATCGGGATGCCTGTCTTTCCCTAGTCTTGGGGTCAGGCAAGTGCTCAAAGTCAGGATAAGCAAACTCTCCTTCCTGGGACTCTGAGGAAAGGCTCATTGATGGGGGAAATGGAGGGAGTGGATTCACTCCAGCTCAGCTCCGGGACAAGATGGCCATGGAGCTCCTGCTACATAAATGTCAGGGACTATCCTGGCTCCATCCTGCCTGCTTCCCTAGCTGCTGCCCAGCACTCACCTTATAAACATCCTTCGAGCTGGAGTTAGCCCGAATTGGTTTCTGTCCCTTGTGACCACTGAGCCCTGGCTGACACAATCACAGGCTGGCGAGCAGAGGTACCAGAC&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-10&SERVICE=plain&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&CMD=Put&FILTER=L&HITLIST_SIZE=5&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairwise&PROGRAM=blastn

<html>
<head><title>An Error Occurred</title></head>
<body>
<h1>An Error Occurred</h1>
<p>301 Moved Permanently</p>
</body>
</html>

---------------------------------------------------

Can anyone suggest a fix?

Thanks,

Jolyon


Dr. Jolyon Holdstock,
Oxford Gene Technology
Begbroke Science Park
Begbroke Hill, Woodstock Road
Begbroke, Oxfordshire
OX5 1PF, UK

T: +44 (0)1865 856852
F: +44 (0)1865 848684
E: [hidden email]<mailto:[hidden email]>
W: www.ogt.com

[cid:image001.png@01CB24EA.6FBDAD80]

Oxford Gene Technology - The Molecular Genetics Company(tm)


  *   CytoSure(tm) arrays<http://www.ogt.com/clinical_genetics> - Class-leading products and services offering the complete array solution for clinical genetics research
  *   Cytocell(r) FISH probes<http://www.cytocell.com> - High-quality products for the detection of gene rearrangements related to inherited genetic disease and cancer
  *   Genefficiency(tm) genomic services<http://www.ogt.com/genomic_services>  - A tailored microarray and sequencing service enabling high-throughput, high-quality genomic studies for a variety of applications

Oxford Gene Technology (Operations) Ltd.  Registered in England No: 03845432 Begbroke Science Park, Begbroke Hill, Woodstock Road, Begbroke, Oxfordshire, OX5 1PF, UK
Confidentiality Notice: The contents of this email from the Oxford Gene Technology Group of Companies are confidential and intended solely for the person to whom it is addressed.  It may contain privileged and confidential information.  If you are not the intended recipient you must not read, copy, distribute, discuss or take any action in reliance on it. If you have received this email in error please advise the sender so that we can arrange for proper delivery.  Then please delete the message from your inbox.  Thank you.
CytoSure(tm) and Genefficiency(tm) NGS browser: For Research Use Only; Not for Use in Diagnostic Procedures<http://www.ogt.co.uk/terms_conditions/trademarks_and_disclaimers>


_______________________________________________
Bioperl-l mailing list
[hidden email]
http://lists.open-bio.org/mailman/listinfo/bioperl-l

image001.png (7K) Download Attachment
Reply | Threaded
Open this post in threaded view
|

Re: remoteblast

Jason Stajich-5
So the BLAST services changed - not sure if we will still even support perl
based - it will require a developer tracking and testing to the new NCBI
resources since the have discontinued the older submission CGI resource.

You can run remote blast with commandline tool from NCBI as an alternative.

I think we will need to have a developer volunteer who wants to keep
working on tracking the webservices for NCBI to keep this module working.

Jason

Jason Stajich
[hidden email]


On Thu, May 8, 2014 at 8:34 AM, Jolyon Holdstock
<[hidden email]>wrote:

> Hi,
>
> I have a script that runs blast jobs against the databases at the NCBI.
>
> I use the  Bio::Tools::Run::RemoteBlast module for the blasting.
>
> It was working but is not now.
>
> The following is an example of the response I now get:
>
> --------------------- WARNING ---------------------
> MSG: req was POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
> User-Agent: bioperl-Bio_Tools_Run_RemoteBlast/1.006901
> Content-Length: 788
> Content-Type: application/x-www-form-urlencoded
>
>
> DATABASE=nr&QUERY=%3EHCV-54_contig_15+%0D%0ATCATAACAACCTTTTATGGTAAATACTAACAGCATGCCCATTTTACATGTGAGGAAACTGAGGCTTAGATCAGGTAAGTAGCTTATTCAGTGTTGCTCAAGTAAATACGTTTTAAGAACCCTCAGCCTCGCTCTCCTCTTCCTCAGGGCACACTTTTTTTTTTTTCCTTCCTACTGTGTGAGCTGTGGTGGGAATGTTAATCGGGATGCCTGTCTTTCCCTAGTCTTGGGGTCAGGCAAGTGCTCAAAGTCAGGATAAGCAAACTCTCCTTCCTGGGACTCTGAGGAAAGGCTCATTGATGGGGGAAATGGAGGGAGTGGATTCACTCCAGCTCAGCTCCGGGACAAGATGGCCATGGAGCTCCTGCTACATAAATGTCAGGGACTATCCTGGCTCCATCCTGCCTGCTTCCCTAGCTGCTGCCCAGCACTCACCTTATAAACATCCTTCGAGCTGGAGTTAGCCCGAATTGGTTTCTGTCCCTTGTGACCACTGAGCCCTGGCTGACACAATCACAGGCTGGCGAGCAGAGGTACCAGAC&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-10&SERVICE=plain&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&CMD=Put&FILTER=L&HITLIST_SIZE=5&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairwise&PROGRAM=blastn
>
> <html>
> <head><title>An Error Occurred</title></head>
> <body>
> <h1>An Error Occurred</h1>
> <p>301 Moved Permanently</p>
> </body>
> </html>
>
> ---------------------------------------------------
>
> Can anyone suggest a fix?
>
> Thanks,
>
> Jolyon
>
>
> Dr. Jolyon Holdstock,
> Oxford Gene Technology
> Begbroke Science Park
> Begbroke Hill, Woodstock Road
> Begbroke, Oxfordshire
> OX5 1PF, UK
>
> T: +44 (0)1865 856852
> F: +44 (0)1865 848684
> E: [hidden email]<mailto:[hidden email]>
> W: www.ogt.com
>
> [cid:image001.png@01CB24EA.6FBDAD80]
>
> Oxford Gene Technology - The Molecular Genetics Company(tm)
>
>
>   *   CytoSure(tm) arrays<http://www.ogt.com/clinical_genetics> -
> Class-leading products and services offering the complete array solution
> for clinical genetics research
>   *   Cytocell(r) FISH probes<http://www.cytocell.com> - High-quality
> products for the detection of gene rearrangements related to inherited
> genetic disease and cancer
>   *   Genefficiency(tm) genomic services<
> http://www.ogt.com/genomic_services>  - A tailored microarray and
> sequencing service enabling high-throughput, high-quality genomic studies
> for a variety of applications
>
> Oxford Gene Technology (Operations) Ltd.  Registered in England No:
> 03845432 Begbroke Science Park, Begbroke Hill, Woodstock Road, Begbroke,
> Oxfordshire, OX5 1PF, UK
> Confidentiality Notice: The contents of this email from the Oxford Gene
> Technology Group of Companies are confidential and intended solely for the
> person to whom it is addressed.  It may contain privileged and confidential
> information.  If you are not the intended recipient you must not read,
> copy, distribute, discuss or take any action in reliance on it. If you have
> received this email in error please advise the sender so that we can
> arrange for proper delivery.  Then please delete the message from your
> inbox.  Thank you.
> CytoSure(tm) and Genefficiency(tm) NGS browser: For Research Use Only; Not
> for Use in Diagnostic Procedures<
> http://www.ogt.co.uk/terms_conditions/trademarks_and_disclaimers>
>
>
> _______________________________________________
> Bioperl-l mailing list
> [hidden email]
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

_______________________________________________
Bioperl-l mailing list
[hidden email]
http://lists.open-bio.org/mailman/listinfo/bioperl-l
Reply | Threaded
Open this post in threaded view
|

Re: remoteblast

Scott Markel-2
In this case the code change is straightforward and doesn't require any change to Bio::Tools::Run::RemoteBlast.  The constructor can take a URL_BASE argument, so just pass in the new URL (http://blast.ncbi.nlm.nih.gov/Blast.cgi).  This will overwrite the old URL (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) hard-coded in Bio::Tools::Run::RemoteBlast.  We made this change to the remote BLAST components in the Pipeline Pilot Sequence Analysis collection and things have been fine.

    my @parameters = ("-prog"       => $program,
                      "-data"       => $database,
                      "-readmethod" => 'xml',
                      "-URL_BASE"   => $url);
   
    my $blastFactory = Bio::Tools::Run::RemoteBlast->new(@parameters);

Hope this helps.

Scott

Scott Markel, Ph.D.
Principal Bioinformatics Architect  email:  [hidden email]
Accelrys (Pipeline Pilot R&D)       mobile: +1 858 205 3653
5005 Wateridge Vista Drive          voice:  +1 858 799 5603
San Diego, CA 92121                 fax:    +1 858 799 5222
USA                                 web:    http://www.accelrys.com

http://www.linkedin.com/in/smarkel
Secretary, Board of Directors:
    International Society for Computational Biology
Chair: ISCB Publications and Communications Committee
Associate Editor: PLOS Computational Biology
Editorial Board: Briefings in Bioinformatics

Important change about my e-mail address: Following Accelrys's joining forces with Dassault Systèmes (3DS), my new e-mail address is [hidden email].  Please add this new address to your Safe Senders list, to ensure you will continue to receive my e-mails.


-----Original Message-----
From: [hidden email] [mailto:[hidden email]] On Behalf Of Jason Stajich
Sent: Wednesday, 14 May 14 2014 7:49 AM
To: Jolyon Holdstock
Cc: [hidden email]
Subject: Re: [Bioperl-l] remoteblast

So the BLAST services changed - not sure if we will still even support perl
based - it will require a developer tracking and testing to the new NCBI
resources since the have discontinued the older submission CGI resource.

You can run remote blast with commandline tool from NCBI as an alternative.

I think we will need to have a developer volunteer who wants to keep
working on tracking the webservices for NCBI to keep this module working.

Jason

Jason Stajich
[hidden email]


On Thu, May 8, 2014 at 8:34 AM, Jolyon Holdstock
<[hidden email]>wrote:

> Hi,
>
> I have a script that runs blast jobs against the databases at the NCBI.
>
> I use the  Bio::Tools::Run::RemoteBlast module for the blasting.
>
> It was working but is not now.
>
> The following is an example of the response I now get:
>
> --------------------- WARNING ---------------------
> MSG: req was POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
> User-Agent: bioperl-Bio_Tools_Run_RemoteBlast/1.006901
> Content-Length: 788
> Content-Type: application/x-www-form-urlencoded
>
>
> DATABASE=nr&QUERY=%3EHCV-54_contig_15+%0D%0ATCATAACAACCTTTTATGGTAAATACTAACAGCATGCCCATTTTACATGTGAGGAAACTGAGGCTTAGATCAGGTAAGTAGCTTATTCAGTGTTGCTCAAGTAAATACGTTTTAAGAACCCTCAGCCTCGCTCTCCTCTTCCTCAGGGCACACTTTTTTTTTTTTCCTTCCTACTGTGTGAGCTGTGGTGGGAATGTTAATCGGGATGCCTGTCTTTCCCTAGTCTTGGGGTCAGGCAAGTGCTCAAAGTCAGGATAAGCAAACTCTCCTTCCTGGGACTCTGAGGAAAGGCTCATTGATGGGGGAAATGGAGGGAGTGGATTCACTCCAGCTCAGCTCCGGGACAAGATGGCCATGGAGCTCCTGCTACATAAATGTCAGGGACTATCCTGGCTCCATCCTGCCTGCTTCCCTAGCTGCTGCCCAGCACTCACCTTATAAACATCCTTCGAGCTGGAGTTAGCCCGAATTGGTTTCTGTCCCTTGTGACCACTGAGCCCTGGCTGACACAATCACAGGCTGGCGAGCAGAGGTACCAGAC&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-10&SERVICE=plain&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&CMD=Put&FILTER=L&HITLIST_SIZE=5&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairwise&PROGRAM=blastn
>
> <html>
> <head><title>An Error Occurred</title></head>
> <body>
> <h1>An Error Occurred</h1>
> <p>301 Moved Permanently</p>
> </body>
> </html>
>
> ---------------------------------------------------
>
> Can anyone suggest a fix?
>
> Thanks,
>
> Jolyon
>
>
> Dr. Jolyon Holdstock,
> Oxford Gene Technology
> Begbroke Science Park
> Begbroke Hill, Woodstock Road
> Begbroke, Oxfordshire
> OX5 1PF, UK
>
> T: +44 (0)1865 856852
> F: +44 (0)1865 848684
> E: [hidden email]<mailto:[hidden email]>
> W: www.ogt.com
>
> [cid:image001.png@01CB24EA.6FBDAD80]
>
> Oxford Gene Technology - The Molecular Genetics Company(tm)
>
>
>   *   CytoSure(tm) arrays<http://www.ogt.com/clinical_genetics> -
> Class-leading products and services offering the complete array solution
> for clinical genetics research
>   *   Cytocell(r) FISH probes<http://www.cytocell.com> - High-quality
> products for the detection of gene rearrangements related to inherited
> genetic disease and cancer
>   *   Genefficiency(tm) genomic services<
> http://www.ogt.com/genomic_services>  - A tailored microarray and
> sequencing service enabling high-throughput, high-quality genomic studies
> for a variety of applications
>
> Oxford Gene Technology (Operations) Ltd.  Registered in England No:
> 03845432 Begbroke Science Park, Begbroke Hill, Woodstock Road, Begbroke,
> Oxfordshire, OX5 1PF, UK
> Confidentiality Notice: The contents of this email from the Oxford Gene
> Technology Group of Companies are confidential and intended solely for the
> person to whom it is addressed.  It may contain privileged and confidential
> information.  If you are not the intended recipient you must not read,
> copy, distribute, discuss or take any action in reliance on it. If you have
> received this email in error please advise the sender so that we can
> arrange for proper delivery.  Then please delete the message from your
> inbox.  Thank you.
> CytoSure(tm) and Genefficiency(tm) NGS browser: For Research Use Only; Not
> for Use in Diagnostic Procedures<
> http://www.ogt.co.uk/terms_conditions/trademarks_and_disclaimers>
>
>
> _______________________________________________
> Bioperl-l mailing list
> [hidden email]
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

_______________________________________________
Bioperl-l mailing list
[hidden email]
http://lists.open-bio.org/mailman/listinfo/bioperl-l



_______________________________________________
Bioperl-l mailing list
[hidden email]
http://lists.open-bio.org/mailman/listinfo/bioperl-l
Reply | Threaded
Open this post in threaded view
|

Re: remoteblast

Fields, Christopher J
In reply to this post by Jason Stajich-5
It seems to be working for me using the regression tests on the 1.6.x branch (taking a while):

[cjfields@cjfields bioperl-live (v1.6.x)]$ export BIOPERLDEBUG=1
[cjfields@cjfields bioperl-live (v1.6.x)]$ prove -lrv t/Tools/Run/RemoteBlast.t
t/Tools/Run/RemoteBlast.t ..
1..21
ok 1 - use Bio::Tools::Run::RemoteBlast;
ok 2
ok 3 - Text BLAST
ok 4 - BLAST text output submitted
ok 5 - Estimated retrieval time
ok 6 - should only be one RID
# Time remaining: 8
# Retrieving R75G4ADZ01R...
# Retrieval attempt: 1

# Retrieval attempt: 2
# Retrieval attempt: 3
# Retrieval attempt: 4
# Retrieval attempt: 5
# Retrieval attempt: 6
# Retrieval attempt: 7
# Retrieval attempt: 8
# Retrieval attempt: 9
# Retrieval attempt: 10
# Retrieval attempt: 11
# Retrieval attempt: 12
# Retrieval attempt: 13
# Retrieval attempt: 14
# Retrieval attempt: 15
retrieve request is POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
Content-Length: 95
Content-Type: application/x-www-form-urlencoded

DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairwise&ALIGNMENTS=50&CMD=Get&RID=R75G4ADZ01R
ok 7 - retrieve_blast succeeded
ok 8 - An object of class 'Bio::SearchIO::blast' isa 'Bio::SearchIO'
sbjct name is sp|P00561.2|AK1H_ECOLI
score is 1567
sbjct name is sp|P00562.3|AK2H_ECOLI
score is 331
sbjct name is sp|P08660.2|AK3_ECOLI
score is 184
ok 9 - HSPs returned
going to remove files /var/folders/2b/8p0tbdb524sdzxdbsbrs5n4w0000gn/T/ezFTzsGnfp
going to remove files /var/folders/2b/8p0tbdb524sdzxdbsbrs5n4w0000gn/T/ezFTzsGnfp
Use of uninitialized value $Bio::Tools::Run::RemoteBlast::MODVERSION in concatenation (.) or string at Bio/Tools/Run/RemoteBlast.pm line 459.
ok 10 - Tabular BLAST submitted
ok 11 - Estimated retrieval time
ok 12 - should only be one RID
# Time remaining: 19
# waiting [R75YBF2B014]...
# Retrieval attempt: 1
retrieve request is POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
Content-Length: 94
Content-Type: application/x-www-form-urlencoded

CMD=Get&RID=R75YBF2B014&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Tabular&ALIGNMENTS=50
ok 13 - retrieve_blast succeeded
ok 14 - An object of class 'Bio::SearchIO::blasttable' isa 'Bio::SearchIO'
sbjct name is gi|34395933|sp|P00561.2|AK1H_ECOLI
score is 1567
sbjct name is gi|416596|sp|P00562.3|AK2H_ECOLI
score is 331
sbjct name is gi|416597|sp|P08660.2|AK3_ECOLI
score is 184
ok 15 - HSPs returned
going to remove files /var/folders/2b/8p0tbdb524sdzxdbsbrs5n4w0000gn/T/jeSXOFZDxr
going to remove files /var/folders/2b/8p0tbdb524sdzxdbsbrs5n4w0000gn/T/jeSXOFZDxr
Use of uninitialized value $Bio::Tools::Run::RemoteBlast::MODVERSION in concatenation (.) or string at Bio/Tools/Run/RemoteBlast.pm line 459.
ok 16 - XML BLAST submitted
ok 17 - Estimated retrieval time
ok 18 - should only be one RID
# Time remaining: 9
# waiting [R75ZA7NV01R]...
# Retrieval attempt: 1
# Retrieval attempt: 2
# Retrieval attempt: 3
# Retrieval attempt: 4



chris

On May 14, 2014, at 9:48 AM, Jason Stajich <[hidden email]> wrote:

> So the BLAST services changed - not sure if we will still even support perl
> based - it will require a developer tracking and testing to the new NCBI
> resources since the have discontinued the older submission CGI resource.
>
> You can run remote blast with commandline tool from NCBI as an alternative.
>
> I think we will need to have a developer volunteer who wants to keep
> working on tracking the webservices for NCBI to keep this module working.
>
> Jason
>
> Jason Stajich
> [hidden email]
>
>
> On Thu, May 8, 2014 at 8:34 AM, Jolyon Holdstock
> <[hidden email]>wrote:
>
>> Hi,
>>
>> I have a script that runs blast jobs against the databases at the NCBI.
>>
>> I use the  Bio::Tools::Run::RemoteBlast module for the blasting.
>>
>> It was working but is not now.
>>
>> The following is an example of the response I now get:
>>
>> --------------------- WARNING ---------------------
>> MSG: req was POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
>> User-Agent: bioperl-Bio_Tools_Run_RemoteBlast/1.006901
>> Content-Length: 788
>> Content-Type: application/x-www-form-urlencoded
>>
>>
>> DATABASE=nr&QUERY=%3EHCV-54_contig_15+%0D%0ATCATAACAACCTTTTATGGTAAATACTAACAGCATGCCCATTTTACATGTGAGGAAACTGAGGCTTAGATCAGGTAAGTAGCTTATTCAGTGTTGCTCAAGTAAATACGTTTTAAGAACCCTCAGCCTCGCTCTCCTCTTCCTCAGGGCACACTTTTTTTTTTTTCCTTCCTACTGTGTGAGCTGTGGTGGGAATGTTAATCGGGATGCCTGTCTTTCCCTAGTCTTGGGGTCAGGCAAGTGCTCAAAGTCAGGATAAGCAAACTCTCCTTCCTGGGACTCTGAGGAAAGGCTCATTGATGGGGGAAATGGAGGGAGTGGATTCACTCCAGCTCAGCTCCGGGACAAGATGGCCATGGAGCTCCTGCTACATAAATGTCAGGGACTATCCTGGCTCCATCCTGCCTGCTTCCCTAGCTGCTGCCCAGCACTCACCTTATAAACATCCTTCGAGCTGGAGTTAGCCCGAATTGGTTTCTGTCCCTTGTGACCACTGAGCCCTGGCTGACACAATCACAGGCTGGCGAGCAGAGGTACCAGAC&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-10&SERVICE=plain&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&CMD=Put&FILTER=L&HITLIST_SIZE=5&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairwise&PROGRAM=blastn
>>
>> <html>
>> <head><title>An Error Occurred</title></head>
>> <body>
>> <h1>An Error Occurred</h1>
>> <p>301 Moved Permanently</p>
>> </body>
>> </html>
>>
>> ---------------------------------------------------
>>
>> Can anyone suggest a fix?
>>
>> Thanks,
>>
>> Jolyon
>>
>>
>> Dr. Jolyon Holdstock,
>> Oxford Gene Technology
>> Begbroke Science Park
>> Begbroke Hill, Woodstock Road
>> Begbroke, Oxfordshire
>> OX5 1PF, UK
>>
>> T: +44 (0)1865 856852
>> F: +44 (0)1865 848684
>> E: [hidden email]<mailto:[hidden email]>
>> W: www.ogt.com
>>
>> [cid:image001.png@01CB24EA.6FBDAD80]
>>
>> Oxford Gene Technology - The Molecular Genetics Company(tm)
>>
>>
>>  *   CytoSure(tm) arrays<http://www.ogt.com/clinical_genetics> -
>> Class-leading products and services offering the complete array solution
>> for clinical genetics research
>>  *   Cytocell(r) FISH probes<http://www.cytocell.com> - High-quality
>> products for the detection of gene rearrangements related to inherited
>> genetic disease and cancer
>>  *   Genefficiency(tm) genomic services<
>> http://www.ogt.com/genomic_services>  - A tailored microarray and
>> sequencing service enabling high-throughput, high-quality genomic studies
>> for a variety of applications
>>
>> Oxford Gene Technology (Operations) Ltd.  Registered in England No:
>> 03845432 Begbroke Science Park, Begbroke Hill, Woodstock Road, Begbroke,
>> Oxfordshire, OX5 1PF, UK
>> Confidentiality Notice: The contents of this email from the Oxford Gene
>> Technology Group of Companies are confidential and intended solely for the
>> person to whom it is addressed.  It may contain privileged and confidential
>> information.  If you are not the intended recipient you must not read,
>> copy, distribute, discuss or take any action in reliance on it. If you have
>> received this email in error please advise the sender so that we can
>> arrange for proper delivery.  Then please delete the message from your
>> inbox.  Thank you.
>> CytoSure(tm) and Genefficiency(tm) NGS browser: For Research Use Only; Not
>> for Use in Diagnostic Procedures<
>> http://www.ogt.co.uk/terms_conditions/trademarks_and_disclaimers>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> [hidden email]
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
> _______________________________________________
> Bioperl-l mailing list
> [hidden email]
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


_______________________________________________
Bioperl-l mailing list
[hidden email]
http://lists.open-bio.org/mailman/listinfo/bioperl-l
Reply | Threaded
Open this post in threaded view
|

Re: remoteblast

Jolyon Holdstock
In reply to this post by Scott Markel-2
Hi Scott,

That worked for me.

Thank you,

Jolyon

-----Original Message-----
From: Scott Markel [mailto:[hidden email]]
Sent: 14 May 2014 17:18
To: Jason Stajich; Jolyon Holdstock
Cc: [hidden email]
Subject: RE: [Bioperl-l] remoteblast

In this case the code change is straightforward and doesn't require any change to Bio::Tools::Run::RemoteBlast.  The constructor can take a URL_BASE argument, so just pass in the new URL (http://blast.ncbi.nlm.nih.gov/Blast.cgi).  This will overwrite the old URL (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) hard-coded in Bio::Tools::Run::RemoteBlast.  We made this change to the remote BLAST components in the Pipeline Pilot Sequence Analysis collection and things have been fine.

    my @parameters = ("-prog"       => $program,
                      "-data"       => $database,
                      "-readmethod" => 'xml',
                      "-URL_BASE"   => $url);
   
    my $blastFactory = Bio::Tools::Run::RemoteBlast->new(@parameters);

Hope this helps.

Scott

Scott Markel, Ph.D.
Principal Bioinformatics Architect  email:  [hidden email] Accelrys (Pipeline Pilot R&D)       mobile: +1 858 205 3653
5005 Wateridge Vista Drive          voice:  +1 858 799 5603
San Diego, CA 92121                 fax:    +1 858 799 5222 USA                                 web:    http://www.accelrys.com

http://www.linkedin.com/in/smarkel
Secretary, Board of Directors:
    International Society for Computational Biology
Chair: ISCB Publications and Communications Committee Associate Editor: PLOS Computational Biology Editorial Board: Briefings in Bioinformatics

Important change about my e-mail address: Following Accelrys's joining forces with Dassault Systèmes (3DS), my new e-mail address is [hidden email].  Please add this new address to your Safe Senders list, to ensure you will continue to receive my e-mails.


-----Original Message-----
From: [hidden email] [mailto:[hidden email]] On Behalf Of Jason Stajich
Sent: Wednesday, 14 May 14 2014 7:49 AM
To: Jolyon Holdstock
Cc: [hidden email]
Subject: Re: [Bioperl-l] remoteblast

So the BLAST services changed - not sure if we will still even support perl based - it will require a developer tracking and testing to the new NCBI resources since the have discontinued the older submission CGI resource.

You can run remote blast with commandline tool from NCBI as an alternative.

I think we will need to have a developer volunteer who wants to keep working on tracking the webservices for NCBI to keep this module working.

Jason

Jason Stajich
[hidden email]


On Thu, May 8, 2014 at 8:34 AM, Jolyon Holdstock
<[hidden email]>wrote:

> Hi,
>
> I have a script that runs blast jobs against the databases at the NCBI.
>
> I use the  Bio::Tools::Run::RemoteBlast module for the blasting.
>
> It was working but is not now.
>
> The following is an example of the response I now get:
>
> --------------------- WARNING ---------------------
> MSG: req was POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
> User-Agent: bioperl-Bio_Tools_Run_RemoteBlast/1.006901
> Content-Length: 788
> Content-Type: application/x-www-form-urlencoded
>
>
> DATABASE=nr&QUERY=%3EHCV-54_contig_15+%0D%0ATCATAACAACCTTTTATGGTAAATAC
> TAACAGCATGCCCATTTTACATGTGAGGAAACTGAGGCTTAGATCAGGTAAGTAGCTTATTCAGTGTTGC
> TCAAGTAAATACGTTTTAAGAACCCTCAGCCTCGCTCTCCTCTTCCTCAGGGCACACTTTTTTTTTTTTC
> CTTCCTACTGTGTGAGCTGTGGTGGGAATGTTAATCGGGATGCCTGTCTTTCCCTAGTCTTGGGGTCAGG
> CAAGTGCTCAAAGTCAGGATAAGCAAACTCTCCTTCCTGGGACTCTGAGGAAAGGCTCATTGATGGGGGA
> AATGGAGGGAGTGGATTCACTCCAGCTCAGCTCCGGGACAAGATGGCCATGGAGCTCCTGCTACATAAAT
> GTCAGGGACTATCCTGGCTCCATCCTGCCTGCTTCCCTAGCTGCTGCCCAGCACTCACCTTATAAACATC
> CTTCGAGCTGGAGTTAGCCCGAATTGGTTTCTGTCCCTTGTGACCACTGAGCCCTGGCTGACACAATCAC
> AGGCTGGCGAGCAGAGGTACCAGAC&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-1
> 0&SERVICE=plain&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&CMD=Put&FILTER=L
> &HITLIST_SIZE=5&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairw
> ise&PROGRAM=blastn
>
> <html>
> <head><title>An Error Occurred</title></head> <body> <h1>An Error
> Occurred</h1>
> <p>301 Moved Permanently</p>
> </body>
> </html>
>
> ---------------------------------------------------
>
> Can anyone suggest a fix?
>
> Thanks,
>
> Jolyon
>
>
> Dr. Jolyon Holdstock,
> Oxford Gene Technology
> Begbroke Science Park
> Begbroke Hill, Woodstock Road
> Begbroke, Oxfordshire
> OX5 1PF, UK
>
> T: +44 (0)1865 856852
> F: +44 (0)1865 848684
> E: [hidden email]<mailto:[hidden email]>
> W: www.ogt.com
>
> [cid:image001.png@01CB24EA.6FBDAD80]
>
> Oxford Gene Technology - The Molecular Genetics Company(tm)
>
>
>   *   CytoSure(tm) arrays<http://www.ogt.com/clinical_genetics> -
> Class-leading products and services offering the complete array
> solution for clinical genetics research
>   *   Cytocell(r) FISH probes<http://www.cytocell.com> - High-quality
> products for the detection of gene rearrangements related to inherited
> genetic disease and cancer
>   *   Genefficiency(tm) genomic services<
> http://www.ogt.com/genomic_services>  - A tailored microarray and
> sequencing service enabling high-throughput, high-quality genomic
> studies for a variety of applications
>
> Oxford Gene Technology (Operations) Ltd.  Registered in England No:
> 03845432 Begbroke Science Park, Begbroke Hill, Woodstock Road,
> Begbroke, Oxfordshire, OX5 1PF, UK Confidentiality Notice: The
> contents of this email from the Oxford Gene Technology Group of
> Companies are confidential and intended solely for the person to whom
> it is addressed.  It may contain privileged and confidential
> information.  If you are not the intended recipient you must not read,
> copy, distribute, discuss or take any action in reliance on it. If you
> have received this email in error please advise the sender so that we
> can arrange for proper delivery.  Then please delete the message from
> your inbox.  Thank you.
> CytoSure(tm) and Genefficiency(tm) NGS browser: For Research Use Only;
> Not for Use in Diagnostic Procedures<
> http://www.ogt.co.uk/terms_conditions/trademarks_and_disclaimers>
>
>
> _______________________________________________
> Bioperl-l mailing list
> [hidden email]
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>

_______________________________________________
Bioperl-l mailing list
[hidden email]
http://lists.open-bio.org/mailman/listinfo/bioperl-l



_______________________________________________
Bioperl-l mailing list
[hidden email]
http://lists.open-bio.org/mailman/listinfo/bioperl-l
Reply | Threaded
Open this post in threaded view
|

Re: remoteblast

Fields, Christopher J
This has also been made the default on the master and 1.6.x branches and will be in the next release.

chris

On May 14, 2014, at 12:23 PM, Jolyon Holdstock <[hidden email]> wrote:

> Hi Scott,
>
> That worked for me.
>
> Thank you,
>
> Jolyon
>
> -----Original Message-----
> From: Scott Markel [mailto:[hidden email]]
> Sent: 14 May 2014 17:18
> To: Jason Stajich; Jolyon Holdstock
> Cc: [hidden email]
> Subject: RE: [Bioperl-l] remoteblast
>
> In this case the code change is straightforward and doesn't require any change to Bio::Tools::Run::RemoteBlast.  The constructor can take a URL_BASE argument, so just pass in the new URL (http://blast.ncbi.nlm.nih.gov/Blast.cgi).  This will overwrite the old URL (http://www.ncbi.nlm.nih.gov/blast/Blast.cgi) hard-coded in Bio::Tools::Run::RemoteBlast.  We made this change to the remote BLAST components in the Pipeline Pilot Sequence Analysis collection and things have been fine.
>
>    my @parameters = ("-prog"       => $program,
>                      "-data"       => $database,
>                      "-readmethod" => 'xml',
>                      "-URL_BASE"   => $url);
>
>    my $blastFactory = Bio::Tools::Run::RemoteBlast->new(@parameters);
>
> Hope this helps.
>
> Scott
>
> Scott Markel, Ph.D.
> Principal Bioinformatics Architect  email:  [hidden email] Accelrys (Pipeline Pilot R&D)       mobile: +1 858 205 3653
> 5005 Wateridge Vista Drive          voice:  +1 858 799 5603
> San Diego, CA 92121                 fax:    +1 858 799 5222 USA                                 web:    http://www.accelrys.com
>
> http://www.linkedin.com/in/smarkel
> Secretary, Board of Directors:
>     International Society for Computational Biology
> Chair: ISCB Publications and Communications Committee Associate Editor: PLOS Computational Biology Editorial Board: Briefings in Bioinformatics
>
> Important change about my e-mail address: Following Accelrys's joining forces with Dassault Systèmes (3DS), my new e-mail address is [hidden email].  Please add this new address to your Safe Senders list, to ensure you will continue to receive my e-mails.
>
>
> -----Original Message-----
> From: [hidden email] [mailto:[hidden email]] On Behalf Of Jason Stajich
> Sent: Wednesday, 14 May 14 2014 7:49 AM
> To: Jolyon Holdstock
> Cc: [hidden email]
> Subject: Re: [Bioperl-l] remoteblast
>
> So the BLAST services changed - not sure if we will still even support perl based - it will require a developer tracking and testing to the new NCBI resources since the have discontinued the older submission CGI resource.
>
> You can run remote blast with commandline tool from NCBI as an alternative.
>
> I think we will need to have a developer volunteer who wants to keep working on tracking the webservices for NCBI to keep this module working.
>
> Jason
>
> Jason Stajich
> [hidden email]
>
>
> On Thu, May 8, 2014 at 8:34 AM, Jolyon Holdstock
> <[hidden email]>wrote:
>
>> Hi,
>>
>> I have a script that runs blast jobs against the databases at the NCBI.
>>
>> I use the  Bio::Tools::Run::RemoteBlast module for the blasting.
>>
>> It was working but is not now.
>>
>> The following is an example of the response I now get:
>>
>> --------------------- WARNING ---------------------
>> MSG: req was POST http://www.ncbi.nlm.nih.gov/blast/Blast.cgi
>> User-Agent: bioperl-Bio_Tools_Run_RemoteBlast/1.006901
>> Content-Length: 788
>> Content-Type: application/x-www-form-urlencoded
>>
>>
>> DATABASE=nr&QUERY=%3EHCV-54_contig_15+%0D%0ATCATAACAACCTTTTATGGTAAATAC
>> TAACAGCATGCCCATTTTACATGTGAGGAAACTGAGGCTTAGATCAGGTAAGTAGCTTATTCAGTGTTGC
>> TCAAGTAAATACGTTTTAAGAACCCTCAGCCTCGCTCTCCTCTTCCTCAGGGCACACTTTTTTTTTTTTC
>> CTTCCTACTGTGTGAGCTGTGGTGGGAATGTTAATCGGGATGCCTGTCTTTCCCTAGTCTTGGGGTCAGG
>> CAAGTGCTCAAAGTCAGGATAAGCAAACTCTCCTTCCTGGGACTCTGAGGAAAGGCTCATTGATGGGGGA
>> AATGGAGGGAGTGGATTCACTCCAGCTCAGCTCCGGGACAAGATGGCCATGGAGCTCCTGCTACATAAAT
>> GTCAGGGACTATCCTGGCTCCATCCTGCCTGCTTCCCTAGCTGCTGCCCAGCACTCACCTTATAAACATC
>> CTTCGAGCTGGAGTTAGCCCGAATTGGTTTCTGTCCCTTGTGACCACTGAGCCCTGGCTGACACAATCAC
>> AGGCTGGCGAGCAGAGGTACCAGAC&COMPOSITION_BASED_STATISTICS=off&EXPECT=1e-1
>> 0&SERVICE=plain&ALIGNMENTS=50&FORMAT_OBJECT=Alignment&CMD=Put&FILTER=L
>> &HITLIST_SIZE=5&DESCRIPTIONS=100&FORMAT_TYPE=Text&ALIGNMENT_VIEW=Pairw
>> ise&PROGRAM=blastn
>>
>> <html>
>> <head><title>An Error Occurred</title></head> <body> <h1>An Error
>> Occurred</h1>
>> <p>301 Moved Permanently</p>
>> </body>
>> </html>
>>
>> ---------------------------------------------------
>>
>> Can anyone suggest a fix?
>>
>> Thanks,
>>
>> Jolyon
>>
>>
>> Dr. Jolyon Holdstock,
>> Oxford Gene Technology
>> Begbroke Science Park
>> Begbroke Hill, Woodstock Road
>> Begbroke, Oxfordshire
>> OX5 1PF, UK
>>
>> T: +44 (0)1865 856852
>> F: +44 (0)1865 848684
>> E: [hidden email]<mailto:[hidden email]>
>> W: www.ogt.com
>>
>> [cid:image001.png@01CB24EA.6FBDAD80]
>>
>> Oxford Gene Technology - The Molecular Genetics Company(tm)
>>
>>
>>  *   CytoSure(tm) arrays<http://www.ogt.com/clinical_genetics> -
>> Class-leading products and services offering the complete array
>> solution for clinical genetics research
>>  *   Cytocell(r) FISH probes<http://www.cytocell.com> - High-quality
>> products for the detection of gene rearrangements related to inherited
>> genetic disease and cancer
>>  *   Genefficiency(tm) genomic services<
>> http://www.ogt.com/genomic_services>  - A tailored microarray and
>> sequencing service enabling high-throughput, high-quality genomic
>> studies for a variety of applications
>>
>> Oxford Gene Technology (Operations) Ltd.  Registered in England No:
>> 03845432 Begbroke Science Park, Begbroke Hill, Woodstock Road,
>> Begbroke, Oxfordshire, OX5 1PF, UK Confidentiality Notice: The
>> contents of this email from the Oxford Gene Technology Group of
>> Companies are confidential and intended solely for the person to whom
>> it is addressed.  It may contain privileged and confidential
>> information.  If you are not the intended recipient you must not read,
>> copy, distribute, discuss or take any action in reliance on it. If you
>> have received this email in error please advise the sender so that we
>> can arrange for proper delivery.  Then please delete the message from
>> your inbox.  Thank you.
>> CytoSure(tm) and Genefficiency(tm) NGS browser: For Research Use Only;
>> Not for Use in Diagnostic Procedures<
>> http://www.ogt.co.uk/terms_conditions/trademarks_and_disclaimers>
>>
>>
>> _______________________________________________
>> Bioperl-l mailing list
>> [hidden email]
>> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>>
>
> _______________________________________________
> Bioperl-l mailing list
> [hidden email]
> http://lists.open-bio.org/mailman/listinfo/bioperl-l
>
>
>
> _______________________________________________
> Bioperl-l mailing list
> [hidden email]
> http://lists.open-bio.org/mailman/listinfo/bioperl-l


_______________________________________________
Bioperl-l mailing list
[hidden email]
http://lists.open-bio.org/mailman/listinfo/bioperl-l